| Regulated Operon: | yfhKLM | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yfhK | + | 928139..928657 | ||||
| yfhL | + | 928742..929074 | ||||
| yfhM | + | 929061..929921 | COG0596 | 
| Operon evidence: | Northern blotting (1.8 kb transcript) | 
|---|---|
| Reference: | Antelmann H, et al. (2000), Huang X, et al. (1999), Genbank D85082 | 
| Comments: | Internal promoters in front of yfhL and yfhM, leading to a 1.2 kb and a 0.9 kb transcript, respectively. SubtiList and Genbank D85082 list a terminator after yfhK, but none after yfhM. Northern blotting results in BSORF show a yfhK, a yfhLM, and a yfhKLM transcript. Huang et al. found a sigW-dependent promoter in front of yfhL; the promoter in front of yfhM has not yet been identified. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | ND | 928069..928111 | ACATGTTTCACCAGCCTGTCAATCAGGGAATACCACTTATATC | Antelmann H, et al. (2000): HB | 
| SigW | Promoter | -38:+6 | 928688..928731 | ATGCATGAAACATTTCTTCTTTCTGCACGTAACAATGAGAAAGG | Huang X, et al. (1999): S1 Cao M, et al. (2002): AR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CATCCGTCTGTCATAATGGCAGACTTTTTCTGTGCGTTT >>>>>>>> <<<<<<<< | yfhM | 


| 
 |