| Regulated Operon: | yfhQ-fabL-sspE | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yfhQ | + | 934991..936100 | COG1194 | |||
| fabL | yfhR, ygaA | + | 936414..937166 | enoyl-acyl carrier protein reductase | COG1028 | fabL-BAC | 
| sspE | + | 937235..937489 | small acid-soluble spore protein (gamma-type SASP) | 
| Operon evidence: | Northern blotting (2.6 kb transcript) | 
|---|---|
| Reference: | Hackett RH & Setlow P (1987), Yamamoto H, et al. (1999), BSORF | 
| Comments: | The gene yfhS is located between yfhQ and fabL on the opposite DNA strand. Internal promoter in front of sspE, leading to a 0.3 kb transcript. The two internal promoters in front of fabL result in a 1.5 kb and a 1.3 kb transcript. The readthrough terminator downstream of yfhQ leads to a 1.2 kb transcript. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| unknown | Promoter | -36:+6 | 934881..934922 | CTTTTTCTTTATTACTATTTAATGTAACATATTATCGTACTG | Yamamoto H, et al. (1999): NB PE | 
| YfhP | Negative | ND | ND | ND | Yamamoto H, et al. (1999): PE RG (during exponential growth) | 
| SigA | Promoter | -43:+5 | 935931..935978 | ACCTGGTATGGAATATTTCAGTGTTTTTCGGTAAAGTAAAACAAGTGT | Yamamoto H, et al. (1999): NB PE | 
| SigA | Promoter | -39:+6 | 936203..936247 | TTGATTGGCCTTCTTCGTTCAAATAAGGCATAATTTGCTGAAAGG | Yamamoto H, et al. (1999): NB PE | 
| unknown | Promoter | -42:+6 | 936131..936178 | CGTGGCTGTAGTCCGCTTCATTGCGCTTCATTCCGCCGCGCGCTTCAA | Yamamoto H, et al. (1999): NB PE | 
| RsfA | Positive | ND | ND | ND | Juan Wu L, et al. (2000): RG DB | 
| SigG | Promoter | -40:+10 | 937180..937229 | AGAGGAATAGCTATACGATCACCTGCACATTCTAATGACCGTGGAGGTGA | Fajardo-Cavazos P, et al. (1991): PE, promoter mutations, RG Nicholson WL, et al. (1989): PE, nuclease protection, RO Sun DX, et al. (1989): RO, nuclease protection, SDS-PAGE, RG, RNAP purification, in-vitro transcription | 
| SpoVT | Negative | ND | ND | ND | Bagyan I, et al. (1996): DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGCACTTCATCTTCGGGTGGAAGTGCTTTTTTCTGTTTGAA >>>>>>>>>> <<<<<<<<<<< | sspE | |||
| TGGCAGGAGAAGCAGCCGCCATCTCGGCTGCTCCGTAAACCATTCTTAAT >>>>>>>>>>>>> <<<<<<<<<< | yfhQ | 


| 
 |