| Regulated Operon: | ylbJ | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ylbJ | - | 1569879..1571105 | COG3314 | 
| Operon evidence: | upstream and downstream genes are in the opposite direction | 
|---|---|
| Reference: | Genbank Z98682 | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -39:+9 | 1571198..1571245 | TATGGTCTAAACTGAACCCCTATGCTCGTATATTAGTACAAAGAATCA | Eichenberger P, et al. (2003): AR, 5'-RACE-PCR | 
| SpoIIID | Negative | ND | ND | ND | Eichenberger P, et al. (2004): GS AR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TGACAAACGGAACAAAAAAAGGATGAGTCAAAACCCTCATCCTTGTCTGAATTTTTG >>>>>>> <<<<<<< | ylbJ | 


| 
 |