| Regulated Operon: | ypqA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ypqA | + | 2336774..2337193 | 
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Genbank L47838 | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -37:+12 | 2336718..2336766 | TTTATAACAACATCTGGCATAGACGCATAATCTGGTTAAAAAAGGCGGT | Eichenberger P, et al. (2004): Race-PCR | 
| SigK | Promoter | -37:+12 | 2336718..2336766 | TTTATAACAACATCTGGCATAGACGCATAATCTGGTTAAAAAAGGCGGT | Eichenberger P, et al. (2004): Race-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CTTTCCAAAAAATAAGCATGAATGAACGATTCATTCATGCTTCTATCATTTAAAA >>>>>>>>>>> <<<<<<<<<<< | ypqA | 


| 
 |