| Regulated Operon: | yqhV-spoIIIAABCDEFGH | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yqhV | yqgE | - | 2536921..2537202 | yqgE-BAC | ||
| spoIIIAA | - | 2535922..2536845 | COG3854 | |||
| spoIIIAB | - | 2535413..2535928 | ||||
| spoIIIAC | - | 2535184..2535390 | spoIIIAC-BAC | |||
| spoIIIAD | - | 2534776..2535177 | spoIIIAD-BAC | |||
| spoIIIAE | - | 2533540..2534757 | ||||
| spoIIIAF | - | 2532923..2533543 | ||||
| spoIIIAG | - | 2532241..2532930 | ||||
| spoIIIAH | - | 2531584..2532240 | 
| Operon evidence: | transcriptional fusions; Northern blotting (5.9 kb transcript) | 
|---|---|
| Reference: | Illing N & Errington J (1991), Yoshida K, et al. (2003), Genbank U35252 | 
| Comments: | Transcriptional fusions showed that spoIIIA contains at least the A, B, and C genes. Northern blotting revealed a yqhV-spoIIIAABCDEFGH transcript. The promoter in front of spoIIIAA may therefore be an internal promoter. BSORF lists a spoIIIAABCDEFGH transcript, in addition to shorter spoIIIAGH and spoIIIAH transcripts. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| YlbO | Negative | ND | ND | ND | Eichenberger P, et al. (2004): AR DB RG | 
| SigE | Promoter | -39:+3 | 2536872..2536913 | CTTGTCATAAAGTCTGCCTCACATCATACATTTTAAAGAAGC | Illing N & Errington J (1991): RG DB PE OV | 
| SpoIIID | Negative | -54:+1 | 2536875..2536929 | CATAAATAAAGAGAGGCTTGTCATAAAGTCTGCCTCACATCATACATTTTAAAGA | Eichenberger P, et al. (2004): FT AR | 
| SigE | Promoter | -40:+14 | 2533240..2533293 | AAATAGAAATACAAGCTTCCCAGCGCGCATATATTCTAGAAGAAATGGCTGTCC | Stragier P (2003): personal communication: PE RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGCCCGCTAAACAAGCGGGCTTTTTGCGTTGCTGT >>>>>>> <<<<<<< | spoIIIAH | 


| 
 |