| Regulated Operon: | yuxH | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yuxH | comB, yufA | - | 3257081..3258310 | COG3434 | 
| Operon evidence: | S1 nuclease mapping | 
|---|---|
| Reference: | Guillen N, et al. (1989), Weinrauch Y, et al. (1989) | 
| Comments: | The 3' ends of the yuxH and the converging yuzC coding regions overlap. The terminator that was found experimentally for yuxH is downstream of yuzC, upstream of degQ. The low-resolution S1 nuclease mapping estimated the termination signal to be about 30 base pairs downstream of the indicated stem-loop. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigA | Promoter | -49:+17 | 3258327..3258392 | TTTTCATGTTTAGACAATTTTCGTCAAATTATTTGATATACTTAGGGGTGAAAGCCGCGCGTATTG | Weinrauch Y, et al. (1989): PE | 
| Spo0A | Negative | -49:+17 | 3258327..3258392 | TTTTCATGTTTAGACAATTTTCGTCAAATTATTTGATATACTTAGGGGTGAAAGCCGCGCGTATTG | Fujita M, et al. (2005): RG Molle V, et al. (2005): ChIP-on-chip, AR GS | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| GAAAAGGCCACAACTTTAGCGTTGCGGTCTTTTTCGGTGTTTGT >>>>>>>>> <<<<<<<<< | yuxH | 


| 
 |