 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ywcJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywcJ | ipa-48r, nirC | + | 3904356..3905126 | COG2116 | nirC-BAC |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Cruz Ramos H, et al. (1995), Presecan E, et al. (1997) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -42:+9 | 3904288..3904337 | TAATTGTGAAATACTTCACAATATCGTGCCATACTATGCTCAATCATGAA |
Cruz Ramos H, et al. (1995): PE Reents H, et al. (2006): PE |
| YdiH | Negative | -59:-24 | 3904282..3904317 | AAAAATTAATTGTGAAATACTTCACAATATCGTGCC |
Larsson JT, et al. (2005): RG DB Reents H, et al. (2006): RG DB SDM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCAAATGCGTGACAAGGCGTTGATAGGAAATGCTGTTTTCATCCACCTTTCGATTAAAGTATTGTTTTATTTTCTCTAT >>>>>>>>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<<<<<<<< |
ywcJ |
|