 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yxjJI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxjJ | + | 3995848..3996111 | ||||
| yxjI | + | 3996240..3996728 | COG4894 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Dartois V, et al. (1998), Yoshida K, et al. (2000) |
| Comments: | Northern blotting experiments by Yoshida et al. show various transcripts of different lengths, some long enough to cover a yxjIJ operon. Internal promoter in front of yxjI. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| DegU | Negative | ND | ND | ND |
Dartois V, et al. (1998): Unpublished data |
| SigW | Promoter | -40:+3 | 3996173..3996215 | GAGCCTGAAACCTTTTCGCCACCTATCCGTAATTTCATACAAG |
Huang X, et al. (1999): S1 Cao M, et al. (2002): AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTCAAGCTCTTCCTTACACAAAGGAAGAGCTTTTTACATGCTTAA >>>>>>>>>> <<<<<<<<<< |
yxjI |
|