| Factor type | AraC/XylS |
|---|---|
| SWISS-PROT | P19219 |
| SubtiList | BG10166 |
| Consensus seq. | ND |
| Comment | adaptative response to DNA alkylation; positive regulation of the adaAB operon |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| adaAB | adaA | SigA | Positive | ND | ND | ND |
Morohoshi F, et al. (1993): FT |
| alkA | alkA | SigA | Positive | 203506..203551 | -58:-13 | AGAATGTAATAGCAAGATAACAAAATGAGTAAAGATGATTATGTGA |
Morohoshi F, et al. (1993): FT |
|