 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | Unique (CIRCE) |
|---|---|
| SWISS-PROT | P25499 |
| SubtiList | BG10662 |
| Consensus seq. | TTAGCACTC---------GAGTGCTAA |
| Comment | the promoters of class I heat-inducible genes are sigA-dependent and have an inverted repeat, called the CIRCE (controlling IR of chaperone expression) element, which is highly conserved among eubacteria; heat-shock and general stress responses are reviewed in Hecker, M. et al., 1996 |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| groESL | groES | SigA | Negative | 649388..649414 | +5:+31 | TTAGCACTCTTTAGTGCTGAGTGCTAA |
Hecker M, et al. (1996): HB GS Voelker U, et al. (1994): 2D PAGE, HB |
| lepA-hemN-hrcA-grpE-dnaKJ-yqeTUV | hrcA | SigA | Negative | 2628875..2628901 | +5:+31 | TTAGCACTCGCTTATTGAGAGTGCTAA |
Zuber U, et al. (1994): SDM HB Voelker U, et al. (1994): 2D PAGE, HB |
|