 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | pucRJKLM |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| pucR | yunI | + | 3328762..3330357 | COG2508TQ | ||
| pucJ | yunJ | + | 3330502..3331851 | COG2233F | ||
| pucK | yunK | + | 3331857..3333149 | COG2233F | ||
| pucL | yunL | + | 3333162..3334646 | COG3648Q | ||
| pucM | yunM | + | 3334646..3334990 | COG2351R |
| Operon evidence: | Northern blotting (6.2 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2003), Beier L, et al. (2002) |
| Comments: | Internal promoter in front of pucJ, leading to a 4.6 kb transcript. Whereas Beier et al. assumed that pucR is transcribed monocistronically, the Northern blotting experiment by Yoshida et al. showed a pucRJKLM transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PucR | Positive | -96:-68 | 3330379..3330407 | AAACGAATCGTTTTTCGTCACTTTCAGCA |
Beier L, et al. (2002): DP |
| SigA | Promoter | -40:+6 | 3330435..3330480 | ATCCAATGACACCCCTCGACCGGAACGATATTATGTTACTAAAGTT |
Beier L, et al. (2002): PE HM |
| TnrA | Positive | -113:-97 | 3330362..3330378 | TGTTACATTTTCTTACA |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGGAAGCCCGCCTCACCGGCGGGCTTCTTTTTGCACTTC >>>>>>> <<<<<<< |
pucM |
|