Transcription factor: PucR

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. WWWCNTTGGTTAA
Comment regulation of puc genes (purine degradation)
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
guaD guaD SigA Positive 1383208..1383243 -72:-37 CCCCCAAATACTTTGTTTATTTTGCACTTTTTTAAG Beier L, et al. (2002): DP
pucABCDE pucA SigA Negative ND ND ND Beier L, et al. (2001): DB
yurHG yurH SigA Positive 3343743..3343778 -81:-46 TGGATACTGTGGCTAAAAAATAAACGTTTTTTTGGT Beier L, et al. (2002): DP
pucH pucH SigA Positive 3328706..3328746 -92:-52 TCTATAAAAACATTGGTTAAGGTGAATAATTTTCAATAGGA Beier L, et al. (2002): DP
ywoE ywoE SigA Positive 3753860..3753910 -96:-46 TGTCTCTTTTTCTTGTTTAAGCTGTTCAAATACAAACGGGAAAATTGTATA Beier L, et al. (2002): DP
pucRJKLM pucJ SigA Positive 3330379..3330407 -96:-68 AAACGAATCGTTTTTCGTCACTTTCAGCA Beier L, et al. (2002): DP
ureABC ureA SigA Positive 3770001..3770025 -78:-54 AAGAAGCTGATTTGGTCAAGGTAAC Brandenburg JL, et al. (2002): RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai