Transcription factor: SinR

Factor type Xre
SWISS-PROT ND
SubtiList ND
Consensus seq. ND
Comment dual-function regulator which is essential for the late-growth processes of competence and motility and is also a repressor of others, e.g., sporulation and subtilisin synthesis. Might be a leucine zipper protein. In aprE there are two binding sites and SinR binds more strongly to the distal site, which contains two dyad symmetry sites
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
aprE aprE SigA Negative 1105846..1105891 -265:-220 ATTGTTCTCACGGAAGCACACGCAGGTCATTTGAACGAATTTTTTC Gaur NK, et al. (1991): DP GS FT
Olmos J, et al. (1997): DB RG
Ogura M, et al. (2003): DB RG
epr epr SigD Negative 3939434..3939466 -407:-375 CGGCCCACTCGTTCCCAAACACACTCGCCATGA Kodgire P, et al. (2006): DP RG GS DB SDM
rok rok None Negative ND ND ND Hoa TT, et al. (2002): RG DB
Hahn J, et al. (1994): DB
Van Sinderen D & Venema G (1994): RG DB; Western blot
yqxM-sipW-tasA yqxM SigA Negative 2555359..2555387 -80:-52 TGAAAACATTCTTTTAAACGAACAAAATG Chu F, et al. (2006): RG GS FT
yqxM-sipW-tasA yqxM SigA Negative 2555281..2555311 -4:+27 TTGTGAAGTTCTTTAAAGAGAACGATTGTCA Chu F, et al. (2006): RG GS FT
eps yveK SigA Negative 3530036..3530075 -163:-124 TCGTTATTTCGTTCATTATAAGGAATTTTTCGTTCTTTAT Kearns DB, et al. (2005): GS FT RG
eps yveK SigA Negative 3529960..3529985 -73:-48 TTTGTTCTCTAAAGAGAACTTATTGG Kearns DB, et al. (2005): GS FT RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai