Transcription factor: YkvE

Factor type MarR-type
SWISS-PROT O31672
SubtiList BG13310
Consensus seq. tATCTcgaAtTCgAGATaaaa
Comment 2-Methylhydroquinone (thiol stress) resistance repressor
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
yvaB yvaB SigA Negative 3446178..3446228 -70:-20 GGAAAGTTAAATAATCTTTAATTCGAGATGTTTTACTTGAAAGTAAATTTC Towe S, et al. (2007): AR 2D-gel GS FT
mhqED yodE SigA Negative 2129996..2130035 -10:+30 AATAATAAATATCTTGAAATCGAGATAAATAGGAGTGAGA Towe S, et al. (2007): AR 2D-gel GS FT
mhqA mhqA SigA Negative 1353030..1353070 +20:+60 TATGATATGATATCTCGAAATCGAGATAAAATAACCTGGAG Towe S, et al. (2007): AR 2D-gel GS HM
mhqNOP ydfN SigA Negative 596305..596479 -15:+160 ATTTTACTATTATCTCATATTCAAGATATTTTAATTTGAGATATTTGGTCGGAAAGATCAGCGATCAAGCGCAACTCTAAGTGTTCAATCGTTGTCAGTTCTTTTACACAATATTCAATATGATTTTTTATAACATAATATCTCGAATTCGAGATAAAAGGGAGTGTAGCGTAAT Towe S, et al. (2007): AR 2D-gel GS FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai