 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | rocDEF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| rocD | - | 4144301..4145506 | COG4992E | rocD-BAC-1 rocD-BAC-2 rocD-STA | ||
| rocE | - | 4142675..4144078 | COG0833E | x0901-BAC-1 x0901-BAC-2 | ||
| rocF | - | 4140735..4141625 | arginase | rocF-BAC |
| Operon evidence: | translational fusion with lacZ; Northern blotting |
|---|---|
| Reference: | Gardan R, et al. (1995), BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AhrC | Positive | -18:+1 | 4145553..4145571 | CTTGCATTTATATAAAGGG |
Miller CM, et al. (1997): GS FT |
| RocR | Positive | -130:-110 | 4145663..4145683 | TATGCAAAAGAATTTTGCACT |
Gardan R, et al. (1995): DP RG HM |
| RocR | Positive | -89:-69 | 4145622..4145642 | ATATCAGAATGTTTTTGCACC |
Gardan R, et al. (1995): DP HM |
| SigL | Promoter | -35:+5 | 4145549..4145588 | CTTGATTTGGCACAGAACTTGCATTTATATAAAGGGAAAG |
Gardan R, et al. (1995): PE |
| Spo0A | Negative | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAACCCCCGCACCCGCGGGGGTTTCAGCGTGTCGA >>>>>>> <<<<<<< |
rocE |
|