Regulated Operon: | spoIVCB-spoIIIC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
spoIVCB | cisB, sigK, sigK | + | 2652219..2652689 | RNA polymerase sporulation-specific sigma factor (sigma-K) (N-terminal half) | sigK-BAC sigK-BAC | |
spoIIIC | sigK, spoIVD, spoIVE, spoIVE | + | 2700564..2700980 | RNA polymerase sporulation-specific sigma factor (sigma-K) (C-terminal half) | sigK-BAC sigK-BAC |
Operon evidence: | upstream and downstream genes are in opposite directions |
---|---|
Reference: | Stragier P, et al. (1989), Errington J, et al. (1988) |
Comments: | spoIVCB and spoIIIC form a composite gene in the mother cell during sporulation by excising the intervening DNA sequence. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
GerE | Negative | -9:+22 | 2652945..2652975 | ATACATTTACATATAGGCTTTTGCCTACATA |
Zheng L, et al. (1992): RO Ichikawa H, et al. (1999): FT RG |
GerE | Negative | -1:+31 | 2652953..2652984 | ACATATAGGCTTTTGCCTACATACTTTTGTGG |
Zheng L, et al. (1992): RO Ichikawa H, et al. (1999): FT RG |
SigE | Promoter | -39:+9 | 2652915..2652962 | CGGTACAGACACAGACAGCCTCCCGGTCACATACATTTACATATAGGC |
Kunkel B, et al. (1988): PE RG |
SigK | Promoter | -39:+9 | 2652915..2652962 | CGGTACAGACACAGACAGCCTCCCGGTCACATACATTTACATATAGGC |
Kunkel B, et al. (1988): PE RG Kroos L, et al. (1989): RO, SDS-PAGE |
SpoIIID | Positive | -36:-16 | 2652918..2652938 | TACAGACACAGACAGCCTCCC |
Halberg R, et al. (1994): FT RO |
SpoIIID | Positive | +78:+100 | 2653031..2653053 | TAAAGAGCTTGTCTTTTTAGTAT |
Halberg R, et al. (1994): FT RO |
SpoIIID | Positive | +109:+133 | 2653062..2653086 | AAAAACAATGCCTTTCCACAACCGC |
Halberg R, et al. (1994): FT RO |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAGAAGCCGGATCTCATACTCCGGCTTTCTCTATTTGAAA >>>>>> <<<<<< |
spoIIIC |
|