 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | ND |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | CTTAAAG-N4-CTTTAAG |
| Comment | Nguyen TT, et al. (2009) speculate that AdhR is redox-regulated via thiol-(S)-alkylation by aldehydes and that AdhA and YraA are specifically involved in reduction of aldehydes and degradation or repair of damaged thiolcontaining proteins respectively. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| yraB | yraB | SigA | Positive | 2755828..2755868 | -40:+1 | AGCTTGACTTAAAGTTAACTTTAAGTGTTACCTTCACAACA |
Nguyen TT, et al. (2009): GS DB |
| yraC | yraC | SigA | Positive | 2755913..2755954 | -40:+1 | ACTTGCCTTAAAGCACACTTTAAACTCTATACTTCTCCATGC |
Nguyen TT, et al. (2009): GS DB |
| yra | adhA | SigA | Positive | 2756199..2756240 | -40:+1 | CCCTTGCCTTAAAGCAGACTTTAAGGTTTATCGTTATGTTGA |
Nguyen TT, et al. (2009): GS DB |
|