 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | amyE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| amyE | amyA | + | 327169..329151 | alpha-amylase | COG0366 | amyA-STR |
| Operon evidence: | Northern blotting (2.0 kb transcript) |
|---|---|
| Reference: | Pereira Y, et al. (2001), BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | -7:+17 | 327041..327064 | TAAATGTAAGCGTTAACAAAATTC |
Kim JH, et al. (1995): GS FT Kim JH, et al. (2005): PE FT |
| DegU | Positive | ND | ND | ND |
Ayusawa D, et al. (1975): amylase activity; DB Yoneda Y & Maruo B (1975): amylase activity; DB Steinmetz M, et al. (1976): amylase activity; DB |
| SigA | Promoter | -50:+17 | 326998..327064 | TTCACTCTGCCAAGTTGTTTTGATAGAGTGATTGTGATAATTTTAAATGTAAGCGTTAACAAAATTC |
Nicholson WL, et al. (1987): S1 Chambliss GH, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 p.85-89: S1 |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGAAAGAAACCATCAATGATGGTTTCTTTTTTGTTCATAAA >>>>>>>>> <<<<<<<<< |
amyE |
|