Regulated Operon: | mmsA-iolBCDEF-idh-iolHI-fbaB |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
mmsA | iolA, yxdA | - | 4081939..4083402 | methylmalonate-semialdehyde dehydrogenase | COG1012 | x1017-BAC |
iolB | yxdB | - | 4081049..4081864 | COG3718 | ||
iolC | yxdC | - | 4080048..4081025 | COG0524 | iolC-BAC-1 iolC-BAC-2 | |
iolD | yxdD | - | 4078102..4079844 | COG3962 | ||
iolE | yxdE | - | 4077192..4078085 | COG1082 | iolE-BAC | |
iolF | yxdF | - | 4075858..4077177 | inositol transport protein | COG0477 | |
idh | iolG, iol | - | 4074801..4075835 | myo-inositol 2-dehydrogenase | COG0673 | idh-BAC idh-BAC |
iolH | yxdG | - | 4073912..4074781 | COG1082 | ||
iolI | yxdH | - | 4072990..4073826 | COG1082 | ||
fbaB | iolJ, yxdI | - | 4072097..4072969 | fructose-1,6-bisphosphate aldolase | COG0191 | fbaA-BAC |
Operon evidence: | S1 nuclease mapping of the 3' end; Northern blotting (11.5 kb transcript) |
---|---|
Reference: | Yoshida K, et al. (1994), Yoshida KI, et al. (1997), Yoshida K, et al. (2000) |
Comments: | The proposed terminator agrees well with the experimentally determined termination site in the TTTTTTT stretch. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CcpA | Negative | +83:+110 | 4083484..4083511 | TTTTTGAAAGCGTTTAATTCTTGGCTTG |
Miwa Y, et al. (2000): DP SDM |
IolR | Negative | -107:-45 | 4083638..4083700 | CCTTCTCTTACTTCTCTTACTTGATTAAAAGATTAATATAATAAAAATAATGAAAAAATGTAG |
Yoshida KI, et al. (1997): DB DP HB |
IolR | Negative | -5:+17 | 4083577..4083598 | TAACCAAGAAATGACCAAAAAG |
Yoshida KI, et al. (1999): GS FT |
SigA | Promoter | -39:+8 | 4083586..4083632 | ATGATTGACTTATGGGTATTATGCGATTAGAATATAACCAAGAAATG |
Yoshida KI, et al. (1997): PE |
CcpA | Negative | ND | 4081178..4081200 | GAAATGAAAACGTTGTCATCGTT |
Miwa Y, et al. (2000): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GAAACCGCCGAGATGGCGTGTTTTTTTGTGCGGTG >>>> <<<< |
fbaB |
|