 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | pucRJKLM |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| pucR | yunI | + | 3327788..3329383 | transcriptional regulator | COG2508 | |
| pucJ | yunJ | + | 3329528..3330877 | uric acid permease | COG2233 | |
| pucK | yunK | + | 3330883..3332175 | uric acid permease | COG2233 | |
| pucL | yunL | + | 3332188..3333672 | uricase | COG3195 | |
| pucM | yunM | + | 3333651..3334016 | uricase | COG2351 |
| Operon evidence: | Northern blotting (6.2 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2003), Beier L, et al. (2002) |
| Comments: | Internal promoter in front of pucJ, leading to a 4.6 kb transcript. Whereas Beier et al. assumed that pucR is transcribed monocistronically, the Northern blotting experiment by Yoshida et al. showed a pucRJKLM transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PucR | Positive | -96:-68 | 3329405..3329433 | AAACGAATCGTTTTTCGTCACTTTCAGCA |
Beier L, et al. (2002): DP |
| SigA | Promoter | -40:+6 | 3329461..3329506 | ATCCAATGACACCCCTCGACCGGAACGATATTATGTTACTAAAGTT |
Beier L, et al. (2002): PE HM |
| TnrA | Positive | -113:-97 | 3329388..3329404 | TGTTACATTTTCTTACA |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGGAAGCCCGCCTCACCGGCGGGCTTCTTTTTGCACTTC >>>>>>> <<<<<<< |
pucM |
|