| Regulated Operon: | rapC-phrC | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| rapC | yclL | + | 428399..429547 | response regulator aspartate phosphatase | COG0457 | |
| phrC | + | 429531..429653 | regulator of the activity of phosphatase RapC and competence and sporulation stimulating factor (CSF) | 
| Operon evidence: | transcriptional fusions; downstream gene is in the opposite direction | 
|---|---|
| Reference: | Carter HL 3rd, et al. (1990), Lazazzera BA, et al. (1999) | 
| Comments: | Northern blotting results in BSORF show various transcripts in this region. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| CodY | Negative | ND | ND | ND | Lazazzera BA, et al. (1999): RG | 
| ComA | Positive | -72:+7 | 428295..428373 | TTGCGTGCTCCCGAAAACAAAGATTGCGTGTTTTTCGGGTTGGGACGGCCTATAAACATGATAAAATATGACATAAACA | Lazazzera BA, et al. (1999): DP HM PE Bongiorni C, et al. (2005): GS | 
| SigA | Promoter | -36:+4 | 428331..428370 | GGGTTGGGACGGCCTATAAACATGATAAAATATGACATAA | Lazazzera BA, et al. (1999): PE | 
| SigH | Promoter | -40:+3 | 429408..429450 | TAGAGGATTTAGCCCTAGAAGTAGCAAAATATTACTATGAACA | Carter HL 3rd, et al. (1990): PE RO, in-vitro transcription Lazazzera BA, et al. (1999): RG DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| ACAAGCCCCTTCTCATTAGCGAGAAGGGGTTTTTCTTTTCAAAA >>>>>>>>> <<<<<<<<< | phrC | 


| 
 |