| Regulated Operon: | sacB-yveBA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sacB | + | 3535042..3536463 | levansucrase | |||
| yveB | + | 3536537..3538087 | COG1621 | |||
| yveA | + | 3538195..3539757 | COG0531 |
| Operon evidence: | Northern blotting (4.9 kb transcript) |
|---|---|
| Reference: | Shimotsu H & Henner DJ (1986), Aymerich S & Steinmetz M (1992), Pereira Y, et al. (2001) |
| Comments: | The readthrough terminators downstream of sacB and yveB lead to a 1.7 kb monocistronic sacB transcript and a 3.3 kb sacB-yveB transcript, respectively. S1 nuclease mapping showed that in the absence of sucrose, transcription terminates at the stem-loop structure upstream of sacB; transcriptional termination is alleviated in the presence of sucrose by SacY (and to a lesser degree SacT) binding to the ribonucleic antiterminator (RAT) sequence. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| DegU | Positive | ND | ND | ND |
Kunst F, et al. (1974): levansucrase activity; DB Steinmetz M, et al. (1976): levansucrase activity; DB Chambert R & Petit-Glatron MF (1984): levansucrase activity; SDS-PAGE DB Aymerich S et al. (1986): RG DB dot-blot Shimotsu H & Henner DJ (1986): S1 RG DB Klier A et al. (1987): levansucrase activity, DB DP Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG |
| SacT | Positive | +54:+96 | 3534853..3534895 | TCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATG |
Steinmetz M, et al. (1989): RG DB |
| SacY | Positive | +54:+96 | 3534853..3534895 | TCGCGCGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATG |
Steinmetz M, et al. (1985): DP RG, levansucrase activity Aymerich S, et al. (1986): RG DB Shimotsu H & Henner DJ (1986): DB RG SDM Steinmetz M & Aymerich S (1986): DP SDM, levansucrase activity Klier A et al. (1987): DB DP RG Aymerich S & Steinmetz M (1987): DB, promoter mutations, levansucrase activity Zukowski M, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 p.17-22: DB DP RG Aymerich S & Steinmetz M (1992): SDM RG |
| SigA | Promoter | -44:+11 | 3534799..3534853 | ATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGAGGTCGAAAAGTAAAT |
Shimotsu H & Henner DJ (1986): S1 Steinmetz M & Aymerich S (1986): DP, levansucrase activity |
| TenA | Positive | ND | ND | ND |
Pang AS, et al. (1991): DB |
| SigG | Promoter | -39:+6 | 3538128..3538172 | AGCGGTATTCTCTGTTACATATTGGGCATTGTAAGGAATATAAGG |
Wang S, et al. (2006): AR, Race-PCR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCAAGACCTAAAATGTGTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTT >>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<< |
sacB | |||
| ATAAAGAAGCAAGAGGTTTTCTTGCTTCTTTATTCTTTACAAA >>>>>>>>> <<<<<<<<< |
yveA | |||
| CAAAAGAAAATGCCGATATCCTATTGGCATTTTCTTTTATTTCT >>>>>>>> <<<<<<<< |
sacB | |||
| AATAAAAACAGGGGCGGCGCAGGCTGCCCCTGTTTTTTTATTAGGAG >>>>>>>>>> <<<<<<<<<< |
yveB |


|