| Regulated Operon: | ybaK-cwlD | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ybaK | ybxH | + | 156108..156551 | |||
| cwlD | + | 156611..157324 | N-acetylmuramoyl-L-alanine amidase | COG0860 | cwlD-BAC | 
| Operon evidence: | Northern blotting (1.2 kb transcript) | 
|---|---|
| Reference: | Sekiguchi J, et al. (1995) | 
| Comments: | Internal promoter in front of cwlD, leading to a 0.73 kb transcript. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| LexA | Negative | -124:-101 | 155964..155987 | ATTACAGAACATTTGTTCCTCACC | Au N, et al. (2005): GS AR DB | 
| SigG | Promoter | -42:+5 | 156046..156092 | AATTCGGGCATTGTTTCATCATCCAAACCTCAAAATAATCGGTAAAA | Sekiguchi J, et al. (1995): PE NB DB | 
| SigE | Promoter | -39:+10 | 156548..156596 | GTAATCATATTTCCCGACCCTGTCCCATAGTTATGTAATAACGGACAAG | Sekiguchi J, et al. (1995): PE NB DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| GGAGACCCTCCGGAGTAATGGAGGGTTTTCTTGTGGTTCT >>>>>>> <<<<<<< | cwlD | 


| 
 |