Regulated Operon: | yqxM-sipW-tasA |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
yqxM | yqhD | - | 2553718..2554479 | |||
sipW | yqhE | - | 2553162..2553734 | type I signal peptidase | COG0681 | x0624-BAC |
tasA | cotN, yqhF | - | 2552313..2553098 | translocation-dependent antimicrobial spore component |
Operon evidence: | lacZ transcriptional fusions; Northern blotting (2.5 kb transcript); upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2003), Stover AG & Driks A (1999) |
Comments: | internal promoters may exist. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigA | Promoter | -42:+4 | 2554536..2554581 | GGTGTTTTTAAATCTATAAATCGTTGATTATACTCTATTTGTGAAG |
Chu F, et al. (2006): PE |
SinR | Negative | -80:-52 | 2554591..2554619 | TGAAAACATTCTTTTAAACGAACAAAATG |
Chu F, et al. (2006): RG GS FT |
SinR | Negative | -4:+27 | 2554513..2554543 | TTGTGAAGTTCTTTAAAGAGAACGATTGTCA |
Chu F, et al. (2006): RG GS FT |
Spo0A | Positive | ND | ND | ND |
Stover AG & Driks A (1999): Western blot Stover AG & Driks A (1999): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CAAAAGAGGAGTTAGTGCCTCTGCTCAGGCACTACTCCTCTTTTTGGGATTTTCT >>>>>>>>>>>>>>> <<<<<<<<<<<<<< |
tasA |
|