| Regulated Operon: | yqxM-sipW-tasA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yqxM | yqhD | - | 2553718..2554479 | |||
| sipW | yqhE | - | 2553162..2553734 | type I signal peptidase | COG0681 | x0624-BAC | 
| tasA | cotN, yqhF | - | 2552313..2553098 | translocation-dependent antimicrobial spore component | 
| Operon evidence: | lacZ transcriptional fusions; Northern blotting (2.5 kb transcript); upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | Yoshida K, et al. (2003), Stover AG & Driks A (1999) | 
| Comments: | internal promoters may exist. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigA | Promoter | -42:+4 | 2554536..2554581 | GGTGTTTTTAAATCTATAAATCGTTGATTATACTCTATTTGTGAAG | Chu F, et al. (2006): PE | 
| SinR | Negative | -80:-52 | 2554591..2554619 | TGAAAACATTCTTTTAAACGAACAAAATG | Chu F, et al. (2006): RG GS FT | 
| SinR | Negative | -4:+27 | 2554513..2554543 | TTGTGAAGTTCTTTAAAGAGAACGATTGTCA | Chu F, et al. (2006): RG GS FT | 
| Spo0A | Positive | ND | ND | ND | Stover AG & Driks A (1999): Western blot Stover AG & Driks A (1999): RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CAAAAGAGGAGTTAGTGCCTCTGCTCAGGCACTACTCCTCTTTTTGGGATTTTCT >>>>>>>>>>>>>>> <<<<<<<<<<<<<< | tasA | 


| 
 |