 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | Xre |
|---|---|
| SWISS-PROT | P06533 |
| SubtiList | BG10754 |
| Consensus seq. | ND |
| Comment | dual-function regulator which is essential for the late-growth processes of competence and motility and is also a repressor of others, e.g., sporulation and subtilisin synthesis. Might be a leucine zipper protein. In aprE there are two binding sites and SinR binds more strongly to the distal site, which contains two dyad symmetry sites |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| aprE | aprE | SigA | Negative | 1105150..1105195 | -265:-220 | ATTGTTCTCACGGAAGCACACGCAGGTCATTTGAACGAATTTTTTC |
Gaur NK, et al. (1991): DP GS FT Olmos J, et al. (1997): DB RG Ogura M, et al. (2003): DB RG |
| epr | epr | SigD | Negative | 3938455..3938487 | -407:-375 | CGGCCCACTCGTTCCCAAACACACTCGCCATGA |
Kodgire P, et al. (2006): DP RG GS DB SDM |
| rok | rok | None | Negative | ND | ND | ND |
Hoa TT, et al. (2002): RG DB Hahn J, et al. (1994): DB Van Sinderen D & Venema G (1994): RG DB; Western blot |
| yqxM-sipW-tasA | yqxM | SigA | Negative | 2554591..2554619 | -80:-52 | TGAAAACATTCTTTTAAACGAACAAAATG |
Chu F, et al. (2006): RG GS FT |
| yqxM-sipW-tasA | yqxM | SigA | Negative | 2554513..2554543 | -4:+27 | TTGTGAAGTTCTTTAAAGAGAACGATTGTCA |
Chu F, et al. (2006): RG GS FT |
| eps | yveK | SigA | Negative | 3529066..3529105 | -163:-124 | TCGTTATTTCGTTCATTATAAGGAATTTTTCGTTCTTTAT |
Kearns DB, et al. (2005): GS FT RG |
| eps | yveK | SigA | Negative | 3528990..3529015 | -73:-48 | TTTGTTCTCTAAAGAGAACTTATTGG |
Kearns DB, et al. (2005): GS FT RG |
|