Transcription factor: PurR

Factor type Purine biosynthesis
SWISS-PROT ND
SubtiList ND
Consensus seq. ANNNCGAA---22-23bp---ANNNTTCGNNNNT
Comment a purine repressor which mediates adenine nucleotide-dependent regulation of pur operon. GAAC-N24-GTTC motif seems necessary for its binding but this motif was not required for its binding to purA
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
glyA glyA SigA Negative 3790541..3790600 -120:-61 AATAAATTCCGAACTTTAAATTAAATTTAAGTTATTAATATTCGTTTTTACCAATAAAAA Saxild HH, et al. (2001): HM DB RG DP SDM
guaC guaC None Negative 3302981..3303033 None TATATAAGGCGAACATTTCATATATTATACTTTTAAATATTCGTTTTTAGGAG Saxild HH, et al. (2001): HM DB RG
nusB-folD nusB None Negative 2529763..2529815 None CGTGAAATCCGAATAATCATATTAAGGTGTGTGAAAATATTCGGTAATAGGGT Saxild HH, et al. (2001): HM RG DB
pbuG pbuG None Negative 694338..694390 None TGTTTATTACGAACAAAATCCGATTTTGCGCGACTATTGTTCGCTTTTTGTAT Saxild HH, et al. (2001): HM RG DB
purA purA SigA Negative 4156804..4156857 -88:-35 GAATGGAAGCGAACGAATATAGATTTACAATAAATTAATGTTCGGATTTACAAT Saxild HH & Nygaard P (1991): Enzyme activity measurement
Weng M, et al. (1995): GS
Shin BS, et al. (1997): GS FT
Rappu P, et al. (1999): RG DP DB
Saxild HH, et al. (2001): HM
Rappu P, et al. (2005): RG SDM GS
purEKBCSQLFMNHD purE SigA Negative 698279..698342 -91:-28 AATTGATCTAAAACACGAACATTAGTAGAATGAATTTTTGTATCGTTCGATAATATCGTTGACA Ebbole DJ & Zalkin H (1987): S1
Ebbole DJ & Zalkin H (1989): RG
Ebbole DJ & Zalkin H (1989): DP RG GS FT
Saxild HH & Nygaard P (1991): Enzyme activity measurement
Weng M, et al. (1995): GS FT DB DP RG
Shin BS, et al. (1997): GS FT SDM
Weng M & Zalkin H (2000): DB RG GS
Saxild HH, et al. (2001): HM RG
Bera AK, et al. (2003): GS DP, ultracentrifugation
Xuan J, et al. (2005): GS SDM RG
Qian J, et al. (2006): Classical genetics
purR-yabJ purR None Negative 54380..54432 None GATTAAATCCGTATGTTAAGTTATATTGATCTTAAAATATTCGGATTTTGGGG Weng M, et al. (1995): GS RG DB
Shin BS, et al. (1997): GS FT
Saxild HH, et al. (2001): HM
pyrRPBCAAABKDFE pyrR SigA Negative 1618044..1618109 -110:-45 GGAGAATATGTCGAATTTGAAGCGCCGCTTCCCGAGGATATGGCAGAATTAATCGAAAACCTCAGA Shin BS, et al. (1997): GS FT
xpt-pbuX xpt SigA Negative 2320255..2320307 -97:-45 CTTGAAATACGAATGATATCTAAAAAAACAAAATTAAAGTTCGGGAATTTTTA Saxild HH, et al. (2001): HM RG DB
ytiP ytiP None Negative 3068849..3068902 None CAAATAAAACGAATAATATTAATGGTGTTTTGTTAAAACGTTCGTAATTGGAGG Saxild HH, et al. (2001): HM DB RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai