 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ptb-bcd-buk-lpdV-bkdAABB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ptb | yqiS, bkd | - | 2502957..2503856 | phosphate butyryltransferase | COG0280 | x0587-CLO |
| bcd | bkd, yqiT | - | 2501851..2502945 | leucine dehydrogenase | COG0334 | |
| buk | yqiU, bkd | - | 2500741..2501832 | branched-chain fatty-acid kinase (butyrate kinase) | COG3426 | x0742-CLO |
| lpdV | yqiV, bkd | - | 2499347..2500720 | branched-chain alpha-keto acid dehydrogenase E3 subunit (dihydrolipoamide dehydrogenase) | COG1249 | |
| bkdAA | bfmBAA, bfmB1a, bkd | - | 2498281..2499273 | branched-chain alpha-keto acid dehydrogenase E1 subunit (2-oxoisovalerate dehydrogenase alpha subunit) | COG1071 | x0194-BAC bfmBAA-STA x0194-BAC |
| bkdAB | bfmBAB, bfmB1b, bkd | - | 2497284..2498267 | branched-chain alpha-keto acid dehydrogenase E1 subunit (2-oxoisovalerate dehydrogenase beta subunit) | COG0022 | bkdAB-BAC bkdAB-BAC |
| bkdB | bfmBB, bfmB2, bkd | - | 2495987..2497261 | branched-chain alpha-keto acid dehydrogenase E2 subunit (lipoamide acyltransferase) | COG0508 | bkdB-BAC bkdB-BAC |
| Operon evidence: | Northern blotting (7.9 kb transcript) |
|---|---|
| Reference: | Nickel M, et al. (2004), Wang GF, et al. (1993), Yoshida K, et al. (2003) |
| Comments: | Northern blotting results in BSORF show various transcripts in this region. Northern blotting experiments by Yoshida et al. show a 8.7 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB transcript. Nickel also found a 10.2 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB transcript due to readthrough at the terminator downstream of bkdR. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| BkdR | Positive | -128:-95 | 2503979..2504012 | AATATGGCCTTGCAAATGAAGGCATGCAATAATT |
Debarbouille M, et al. (1999): DB |
| BkdR | Positive | -114:-81 | 2503965..2503998 | AATGAAGGCATGCAATAATTTGCAGAATAAACGC |
Debarbouille M, et al. (1999): DB |
| BkdR | Positive | -93:-60 | 2503944..2503977 | GCAGAATAAACGCAAACATCTGCACGAATGTTTC |
Debarbouille M, et al. (1999): DB |
| CodY | Negative | ND | ND | ND |
Debarbouille M, et al. (1999): RG |
| SigL | Promoter | -34:+8 | 2503877..2503918 | TAAGAGCTGGCATGGAACTTGCATAATAAAAGGCGGAGTCGA |
Debarbouille M, et al. (1999): PE |
| TnrA | Negative | ND | ND | ND |
Debarbouille M, et al. (1999): RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAAAAGAGCATTTTTTGAAGTTTTGTTTCAAAAAATGCTCTTTTTCTATGCTTTATT >>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< |
bkdB |
|