| Factor type | Unique (CRP/FNR family) |
|---|---|
| SWISS-PROT | P46908 |
| SubtiList | BG11343 |
| Consensus seq. | TGTGA------TCACA |
| Comment | same binding consensus with E. coli CAP exists in the narK-fnr operon |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| arfM | arfM | SigA | Positive | 3829694..3829717 | -52:-29 | AGGCTGTGAAATACATCACTGCTG |
Marino M, et al. (2001): RG SDM DB Cruz Ramos H, et al. (1995): HM Reents H, et al. (2006): AR |
| hemZ | hemZ | SigA | Positive | ND | ND | ND |
Homuth G, et al. (1999): RG |
| narGHJI | narG | SigA | Positive | 3829024..3829053 | -53:-24 | AGTGTGTGACATAGTTCACAAGGAAACACG |
Cruz Ramos H, et al. (1995): DB PE Reents H, et al. (2006): DB NB AR RG SDM |
| narK-fnr | narK | SigA | Positive | 3832599..3832620 | -52:-31 | ACGTGTGATGTAATTCACAATC |
Cruz Ramos H, et al. (1995): DB PE Reents H, et al. (2006): AR |
|