Regulated Operon: yqxD-dnaG-sigA

Genes
Genes Synonyms Direction Genome position Function COG ID Conserved groups
yqxD yqfM - 2603373..2603867
COG1671S  
dnaG dnaE - 2601528..2603339
COG0358L dnaG-OYP-1 dnaG-OYP-2 dnaG-STA dnaG-STR dnaE-STA dnaE-STR  
sigA crsA - 2600214..2601329
COG0568K sigA-STA  

Operon evidence: subcloning into a terminator-probe plasmid
Reference: Wang LF & Doi RH (1986), Wang LF & Doi RH (1987)
Comments: Internal promoters in front of dnaG and sigA. For the dnaG-sigA transcript, dnaG is transcribed but not translated.


Promoters

Binding
factor
Regulation Location Absolute position Binding seq.(cis-element) Experimental evidence
SigA Promoter -42:+5 2604022..2604068 AACAATAGCATCTTTGTGAAGTTTGTATTATAATAAAAAATTGTGAT Wang LF, et al. (1987): S1
SigA Promoter -42:+4 2604050..2604095 TGGCTGTGCCAAAAGGGAATAATGAAAAACAATAGCATCTTTGTGA Wang LF, et al. (1987): S1
SigB Promoter -41:+8 2604059..2604107 ATCCTGGGTTTTTGGCTGTGCCAAAAGGGAATAATGAAAAACAATAGCA Liao CT, et al. (1999): PE
unknown Promoter -43:+4 2603967..2604013 TAATTTTAGGTTTAAGGATCGTGTGATACGAATAAACTATTATGGGT Qi FX, et al. (1991): PE DB
SigH Promoter -42:+7 2603346..2603394 CGATGAAGGGATTTTGCACTAAAGCATCGAATAATGTACGACGGAGTGT Qi FX & Doi RH (1990): PE RG
SigH Promoter -46:+5 2603836..2603886 GCTTTTATGCAGGAGTTTAATGGAGGGATGGAGAATTACTCTTCTTAATGA Carter HL 3rd, et al. (1988): PE DB RG
Spo0A Negative ND ND ND Molle V, et al. (2003): GS CH
SigD Promoter ND 2601522..2601574 CTTCTTTGGCTCAAGAAATCGTTACATTGAACCGATCTTTAAAATAACTGGAG Wang LF, et al. (1985): HM
Briat JF, et al. (1985): S1

Terminator

Terminator sequence Absolute position Position from stop codon Free energy
[kcal/mol]
Downstream of
AAGATGGAACGGGTCTTGAAGATCCGTTCTTCTTTTTTTAAAAAGAT
     >>>>>>>>>>>   <<<<<<<<<<<
2600186..2600210
4..28
-18.4
sigA

Overview



Upper Region






Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai