Transcription factor: SigH

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. AGGTATT(-35) , GAATT(-10)
Comment RNA Polymerase Sigma-30 Factor (Sigma-H). Non-essential sigma factor involved in expression of vegetative and early stationary-phase genes
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
citG citG 3390439..3390486 -43:+5 AAAAATAAAAAGGATTTTTTGTGTCATTGGCGAATTATGATCTATTGA Feavers IM, et al. (1988): S1 DB, fumarase activity
Tatti KM, et al. (1990): PE
yqxD-dnaG-sigA dnaG 2603346..2603394 -42:+7 CGATGAAGGGATTTTGCACTAAAGCATCGAATAATGTACGACGGAGTGT Qi FX & Doi RH (1990): PE RG
yqxD-dnaG-sigA dnaG 2603836..2603886 -46:+5 GCTTTTATGCAGGAGTTTAATGGAGGGATGGAGAATTACTCTTCTTAATGA Carter HL 3rd, et al. (1988): PE DB RG
ftsAZ ftsA 1596294..1596343 -42:+8 GATATAAAAGAGGATATACATAGGATATAACGAATATTTTCAATAAACAT Gonzy-Treboul G, et al. (1992): PE RG
Gholamhoseinian A, et al. (1992): PE S1 RG
Fukuchi K, et al. (2000): DP RG
hbs hbs 2385836..2385892 -50:+7 GAATCAGACTGAACTGTGAAGAAATGATAATAAACGAACTGAATGTATCCTTTTGGG Micka B, et al. (1991): PE
Micka B & Marahiel MA (1992): PE NB
Fernandez S & Alonso JC (1999): RG
kinA kinA 1469927..1469979 -42:+11 TAAGAATAGAAGGAGAATACTCATTTTCTAGCGAATCATACTAGGTAAAAGTC Predich M, et al. (1992): PE, in vitro addition of E-SigH
Antoniewski C, et al. (1990): RG
lytE lytE 1018951..1018994 -35:+9 AAAAAAAGAGATACATATATATAGAGTTAACATTTGGGGAGGAA Ishikawa S, et al. (1998): PE
mreBCD-minCD minC 2859279..2859320 None GTAAAAAGGATTTTATCTTTTTTTGACGAAATGAGTATGTTG Lee S & Price CW (1993): RG
rapC-phrC phrC 429840..429882 -40:+3 TAGAGGATTTAGCCCTAGAAGTAGCAAAATATTACTATGAACA Carter HL 3rd, et al. (1990): PE RO, in-vitro transcription
Lazazzera BA, et al. (1999): RG DB
rapE-phrE phrE 2660209..2660268 -50:+10 GAAGAGCTGGCATTGTTAGGAGGCAACCTTTTCGATTATAATGGAAAAATAGAGGATAGT McQuade RS, et al. (2001): PE RG DB
rapE-phrE phrE 2660258..2660299 -38:+4 TAGAGGATAGTATCATCTGTTTCAAGAAGATGGTATATGCTC McQuade RS, et al. (2001): PE RG DB
rapF-phrF phrF 3847007..3847047 -36:+5 TTGAAGATTTCGCTATTGATGTGGCAAAATATTATCATGAA McQuade RS, et al. (2001): PE RG DB
rapG-phrG phrG 4141080..4141121 -38:+4 TGAAGGAAAAATTGACTGCTGAGCCGAATAGAATATGTGAGG McQuade RS, et al. (2001): PE RG DB
Ogura M, et al. (2003): DB NB RG
rapI-phrI phrI 548355..548396 -40:+2 ACAAGGAAATTTAATGCTCTCTAATGAATATTATCGTATGAG McQuade RS, et al. (2001): PE RG DB
rapK-phrK phrK 2062988..2063029 -38:+4 CACAGGAAAGACTCATATTAATGGAGAATAAAGTATACGAAG McQuade RS, et al. (2001): PE RG DB
spo0A spo0A 2518868..2518914 -43:+4 ATTTTTTTAGAGGGTATATAGCGGTTTTGTCGAATGTAAACATGTAG Predich M, et al. (1992): PE
Chibazakura T, et al. (1995): S1 DB RG
Eymann C, et al. (2001): NB DB; Western blot
spo0F spo0F 3809958..3810009 -43:+9 TTATAATTAAAGGAAATAGGAAAATCAAACAGAATACATACAATACTGCTTA Predich M, et al. (1992): PE, in-vitro transcription, dinucleotide priming
Lewandoski M, et al. (1986): S1
spo0M spo0M 954199..954240 None AATAATAGGAAAAAAGTATGAATCAAACGAATCTTTTTTCCT Han WD, et al. (1998): DB, in vitro experiments
dacF-spoIIAAB-sigF spoIIAA 2445021..2445069 -44:+5 GTCACGGTGAAGGAATTCATTCCGTCGAAATCGAAACACTCATTATCCG Wu JJ, et al. (1989): PE DP RG DB
Wu JJ, et al. (1991): DP RG RO PE
spoVG spoVG 55787..55833 -44:+3 AAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGATACACTAAT Segall J & Losick R (1977): NB DB
Haldenwang WG & Losick R (1979): RO, RNAP purification
Haldenwang WG & Losick R (1980): In vitro transcription, RNA polymerase-DNA binding assay
Haldenwang WG, et al. (1981): In vitro transcription, RNAP purification
Moran CP, et al. (1981): S1 RO DP dinucleotide-primed transcription
Banner CD, et al. (1983): DP RO
Johnson WC, et al. (1983): RO, RNAP purification
Zuber P & Losick R (1983): S1 RG
Carter HL, et al. (1986): RO, RNAP purification
Lampe M, et al. (1986): RNA Polymerase and the regulation of transcription, pp. 177-183: DB RG
Lampe M, et al. (1986): DB RG
Dubnau E, et al. (1988): immunoblot, Western blot
Zuber P., et al. (1989): SDM RG
Eymann C, et al. (2001): DB NB
spoVS spoVS 1769772..1769813 None AAAAGCAGGAATATAGCAACTCCTTAGTGAATATAGTAAAAA Resnekov O, et al. (1995): RG NB
ureABC ureA 3769375..3769422 -44:+4 AACAATTGGAAGGAATTCAGATTTTAATTGTCGAACTAGTCAGACAAG Wray LV Jr, et al. (1997): PE RG
yoxA-dacC yoxA 2000874..2000918 None TATTTGATAGGGGAAAATATAAAATGGAGGAAATATGGTACAGTA Pedersen LB, et al. (1998): RG SDS-PAGE
ytxGHJ ytxG 3048086..3048135 -45:+5 AAAGCTTATTAAAGGATTTTCTTACATAACGGAGAATAGTATGTATACAG Varon D, et al. (1996): PE DB RG, plasmid integration
yvyD yvyD 3631596..3631639 -39:+5 CAGCAGGAATTGTAAAGGGTAAAAGAGAAATAGATACATATCCT Drzewiecki K, et al. (1998): PE NB DB
Eymann C, et al. (2001): PE
racA ywkC ND ND ND Ben-Yehuda S, et al. (2003): DB RG
Wu LJ & Errington J (2003): DB Western blot




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai