Transcription factor: CtsR

Factor type	two-component response regulator
SWISS-PROT	ND
SubtiList	ND
Consensus seq.	A/GGTCAAA NAN A/GGTCAAA
Comment	binding to a directly repeated heptanucleotide operator sequence (A/GGTCAAANANA/GGTCAAA); three functional domains: HTH DNA-binding, dimerization, and putative heat-sensing domains; active as a dimer; specifically degraded by ClpP and ClpX at 37 degrees C; labile and substrate of the ClpCP protease under stress conditions (autoregulation by controlled proteolysis); negatively regulates its own synthesis
Link to	Phylogenetic profile, Weight matrix & Motif alignment

Operon	Regulated Gene	Sigma	Regulation	Absolute position	Location	Binding seq.(cis-element)	Experimental evidence
clpE	clpE	SigA	Negative	`1437936..1437959`	`-33:-9`	AAAGTCAAAGATAGTCAGAGTATA	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437908..1437932`	`-5:+20`	TTAATCAAAGTTGGTCAAACAAACC	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437865..1437888`	`+40:+63`	TTGGTCAAAGATAGTCAAATATTC	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437790..1437813`	`-5:+19`	ATAGTCAAAGAAGGTCAAACCCAA	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437743..1437767`	`+42:+66`	TTGGTCAAAGATGATCAAATTATTA	Derre I, et al. (1999): GS FT
clpP	clpP	SigA	Negative	`3546165..3546181`	`-36:-20`	TTTGACCTTTATTGACC	Derre I, et al. (1999): GS FT
clpX	clpX	SigA	Negative	ND	ND	ND	Kruger E, et al. (1998): DB
ctsR-mcsAB-clpC-radA-yacK	ctsR	SigA	Negative	`101409..101437`	`+1:+29`	AAAGTCAAATATAGTCAAAGTCAGTAAAG	Derre I, et al. (1999): GS FT
lonA-ysxC	lonA	SigA	Negative	ND	ND	ND	Kruger E, et al. (1998): DB
trxA	trxA	None	Negative	ND	ND	ND	Kruger E, et al. (1998): DB