Transcription factor: SpoIIID

Factor type Unique (DeoR family)
SWISS-PROT ND
SubtiList ND
Consensus seq. WWRRACAR-Y
Comment A bi-functional transcription factor which regulates temporal expression of many genes in the mother cell as well as GerE
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
asnO asnO SigE Positive ND ND ND Eichenberger P, et al. (2004): GS AR
bofA bofA SigE Negative 29727..29756 -17:+13 TCTCATAAGCTTGTACTAGAACAAGCGAAG Ireton K & Grossman AD (1992): RG DB
Halberg R, et al. (1994): FT RO
Eichenberger P, et al. (2004): GS AR
bofA bofA SigE Negative 29797..29817 +54:+74 TTATTTTAGGACTGGTTATTC Ireton K & Grossman AD (1992): RG DB
Halberg R, et al. (1994): FT RO
Eichenberger P, et al. (2004): GS AR
cotA cotA SigK Negative ND ND ND Halberg R, et al. (1995): RO
cotC cotC SigK Negative 1905237..1905307 -86:-16 TCTTTTTCTATCATTTGGACAGCCCTTTTTTCCTTCTATGATTTTAACTGTCCAAGCCGCAAAATCTACTC Ichikawa H, et al. (2000): GS FT
cotD cotD SigK Negative 2333101..2333121 -79:-59 AAAGACAGCTTAATTGCACAC Halberg R, et al. (1994): FT RO
cotD cotD SigK Negative 2333063..2333082 -40:-21 CATCAGAACATGTACCCCTT Halberg R, et al. (1994): FT RO
cotD cotD SigK Negative 2332964..2332989 +54:+79 TGATGGCGCCAATTGTCCATCCTACT Halberg R, et al. (1994): FT RO
cotF cotF SigK Positive ND ND ND Eichenberger P, et al. (2004): GS AR
cotJABC-yesJK cotJA SigE Positive 755829..755858 -48:-19 AAGTCGTGTTTTAGTCATAATCATGCCTCC Henriques AO, et al. (1995): DB RG
cotT cotT SigK Positive ND ND ND Eichenberger P, et al. (2004): GS AR
cotVWX cotX SigK Negative 1251201..1251230 -35:-7 AGTCAAAATAAGAGGCTCGCTCATTTAATA Ichikawa H, et al. (2000): GS FT
gerE gerE SigK Positive ND ND ND Halberg R, et al. (1995): RO
gerM gerM SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
spoIID spoIID SigE Negative 3777784..3777844 -60:+1 ATAAAGTTTCTGTCCAAAACGAGAGTCATATTAGCTTGTCCCTGCCCATAGACTAGACTAG Eichenberger P, et al. (2004): FT GS AR
yqhV-spoIIIAABCDEFGH spoIIIAA SigE Negative 2537640..2537697 -55:+3 CATAAATAAAGAGAGGCTTGTCATAAAGTCTGCCTCACATCATACATTTTAAAGAAGC Eichenberger P, et al. (2004): FT AR
yqhV-spoIIIAABCDEFGH spoIIIAG SigE Negative 2534009..2534062 -40:+14 AAATAGAAATACAAGCTTCCCAGCGCGCATATATTCTAGAAGAAATGGCTGTCC Guillot C, et al. (2007): DB,RG,PE,HM
spoIVA spoIVA SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
spoIVCA spoIVCA SigE Positive 2654997..2655030 -47:-12 TTAAAATCTCCTCATTTGGACAAACAGCTGTTAC Halberg R, et al. (1994): FT RO
Eichenberger P, et al. (2004): GS AR
spoIVCA spoIVCA SigE Positive 2654831..2654848 +137:+154 CGACCGAGGAACAAGCGA Halberg R, et al. (1994): FT RO
Eichenberger P, et al. (2004): GS AR
spoIVCB-spoIIIC spoIVCB SigE Positive 2652918..2652938 -36:-16 TACAGACACAGACAGCCTCCC Halberg R, et al. (1994): FT RO
spoIVCB-spoIIIC spoIVCB SigE Positive 2653031..2653053 +78:+100 TAAAGAGCTTGTCTTTTTAGTAT Halberg R, et al. (1994): FT RO
spoIVCB-spoIIIC spoIVCB SigE Positive 2653062..2653086 +109:+133 AAAAACAATGCCTTTCCACAACCGC Halberg R, et al. (1994): FT RO
spoIVFAB spoIVFA SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
spoVB spoVB SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
spoVD spoVD SigE Negative 1584153..1584171 -33:-21 TTCTACCTGTCCAAATTCA Zhang B, et al. (1997): RO FT GS
spoVD spoVD SigE Negative 1584177..1584193 -9:+8 AAAATGAAACAAGCCTA Zhang B, et al. (1997): RO FT GS
murE-mraY-murD-spoVE-murG-murB-divIB-ylxWX-sbp spoVE SigE Negative 1590079..1590137 -38:+21 GGGAATACAACATGTCAAACGTGTCGATAATGTTGAACAAGCAGTATCTGCGGCGTTTG Eichenberger P, et al. (2004): FT AR
murE-mraY-murD-spoVE-murG-murB-divIB-ylxWX-sbp spoVE SigE Negative 1590218..1590276 -38:+21 GGTGACATGTTTATAGATGCCGTGCATATGCTTAAGTAAGGGCTTGTCTTGAAGTAAAT Eichenberger P, et al. (2004): FT AR
spoVK spoVK SigE Positive ND ND ND Eichenberger P, et al. (2004): GS AR
spoVM spoVM SigE Positive ND ND ND Levin PA, et al. (1993): DB RG
yabMNOPQ-divIC-yabR yabP SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
ybaN ybaN SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
ycgFG ycgF SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
yitE yitE SigE (?) Negative ND ND ND Eichenberger P, et al. (2004): GS AR
ykvUV ykvU SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
ylbJ ylbJ SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
ypjB ypjB SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
yqfCD yqfC SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR
yqfZY yqfZ SigE Negative ND ND ND Eichenberger P, et al. (2004): GS AR




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai