Transcription factor: CtsR

Factor type	two-component response regulator
SWISS-PROT	P37568
SubtiList	BG10145
Consensus seq.	A/GGTCAAA NAN A/GGTCAAA
Comment	binding to a directly repeated heptanucleotide operator sequence (A/GGTCAAANANA/GGTCAAA); three functional domains: HTH DNA-binding, dimerization, and putative heat-sensing domains; active as a dimer; specifically degraded by ClpP and ClpX at 37 degrees C; labile and substrate of the ClpCP protease under stress conditions (autoregulation by controlled proteolysis); negatively regulates its own synthesis
Link to	Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon	Regulated Gene	Sigma	Regulation	Absolute position	Location	Binding seq.(cis-element)	Experimental evidence
clpE	clpE	SigA	Negative	`1437244..1437267`	`-33:-9`	AAAGTCAAAGATAGTCAGAGTATA	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437216..1437240`	`-5:+20`	TTAATCAAAGTTGGTCAAACAAACC	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437173..1437196`	`+40:+63`	TTGGTCAAAGATAGTCAAATATTC	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437098..1437121`	`-5:+19`	ATAGTCAAAGAAGGTCAAACCCAA	Derre I, et al. (1999): GS FT
clpE	clpE	SigA	Negative	`1437051..1437075`	`+42:+66`	TTGGTCAAAGATGATCAAATTATTA	Derre I, et al. (1999): GS FT
clpP	clpP	SigA	Negative	`3545195..3545211`	`-36:-20`	TTTGACCTTTATTGACC	Derre I, et al. (1999): GS FT
clpX	clpX	SigA	Negative	ND	ND	ND	Kruger E, et al. (1998): DB
ctsR-mcsAB-clpC-radA-yacK	ctsR	SigA	Negative	`101406..101434`	`+1:+29`	AAAGTCAAATATAGTCAAAGTCAGTAAAG	Derre I, et al. (1999): GS FT
lonA-ysxC	lonA	SigA	Negative	ND	ND	ND	Kruger E, et al. (1998): DB
trxA	trxA	None	Negative	ND	ND	ND	Kruger E, et al. (1998): DB