Transcription factor: CcpA

Factor type LacI family
SWISS-PROT ND
SubtiList ND
Consensus seq. WTGNAANCGNWNNCW
Comment also called AlsA; common repressor in catabolite repression (CR) but may act as a positive regulator of genes involved in excretion of excess carbon; its binding site is called CRE; it binds to fructose-1,6-bisphosphate and HPr
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ackA ackA SigA Positive 3016499..3016513 -124:-110 TGTAAGCGTTCATCA Grundy FJ, et al. (1993): DB DP
ackA ackA SigA Positive 3016430..3016463 -74:-41 GACTTCTTATTGTAAGCGTTATCAATACGCAAGT Grundy FJ, et al. (1993): DB DP
acoABCL acoA SigL Negative 879432..879454 +459:+481 AAAATGTAAGCGTTTGCTTTTTC Miwa Y, et al. (2000): RG
acoR-sspH acoR None Negative 883687..883712 None ATTGTTGAAAGCGCTTTATTTTTCCC Ali NO, et al. (2001): FT
acsA acsA SigA Negative 3039911..3039924 +38:+51 TGAAAGCGTTACCA Grundy FJ, et al. (1994): DB SDM
acuABC acuA SigA Negative 3040018..3040031 -33:-20 TGAAAACGCTTTAT Grundy FJ, et al. (1994): DB SDM
alsSD alsS SigA Positive ND ND ND Renna MC, et al. (1993): DB
amyE amyE SigA Negative 327490..327513 -7:+17 TAAATGTAAGCGTTAACAAAATTC Kim JH, et al. (1995): GS FT
Kim JH, et al. (2005): PE FT
araABDLMNPQ-abfA araA SigA Negative 2948889..2948922 +50:+83 CTTTTGTATTTGAAAGCGTTTTATTTTATGAGAA Inacio JM, et al. (2003): RG NB
araABDLMNPQ-abfA araB None Negative 2946674..2946696 None TCAATGAAAACGATTACAAAGGA Miwa Y, et al. (2000): RG
araE araE SigA Negative 3485490..3485503 +67:+80 TGAAAACGCTTTAC Inacio JM, et al. (2003): RG NB
bglPH-yxiE bglP SigA Negative 4035814..4035863 -47:+3 AAAATGAAAGCGTTGACATCTCACGAATCTAGTGCTAAAGTATACCTACA Kruger S, et al. (1996): RO DP
licT-bglS bglS SigA Negative 4012590..4012603 None AGAAAACGCTTTCA Kruger S, et al. (1993): SDM DB
ykuJK-ykzF-ykuL-ccpC ccpC SigA Negative 1485932..1485953 -81:-60 GAAAAAAGAAAGCGCATACATA Kim HJ, et al. (2002): GS FT
citM-yflN citM SigA Negative 834348..834370 +37:+59 AAAATGTAAGCGGATTCATTTAA Miwa Y, et al. (2000): RG
citZ-icd-mdh citZ SigA Negative 2982367..2982384 +80:+97 AATGTAAGCATTTTCTTT Kim HJ, et al. (2002): PE DB RG SDM GS
cydABCD cydA SigA Negative 3979398..3979427 -8:-37 CTTTATTTTTGAAATGAATCGTTGTAAAGT Puri-Taneja A, et al. (2007): RG FT
dctSRP dctP SigA Negative 500081..500130 -43:+7 TCATAAACTTCCCCAGACTGTATGAAAACGCTATCATTCTAGTAAGAAAG Miwa Y, et al. (2000): RG
Asai K, et al. (2000): DP RG DB
deoR-dra-nupC-pdp dra SigA Negative 4052221..4052243 +62:+84 GCTTTGAAACCGCATACACAAAA Miwa Y, et al. (2000): RG
galKT galT None Negative 3920402..3920424 None CGAATGGAAGCGGATACAGATAC Miwa Y, et al. (2000): RG
glpFK glpF SigA Negative 1002317..1002335 -37:-19 GATTGACACCGCTTTCATG Darbon E, et al. (2002): RG FT
gntRKPZ gntR SigA Negative 4113520..4113542 +138:+160 TGATTGAAAGCGGTACCATTTTA Miwa Y, et al. (1993): SDM S1 HB
Chauvaux S, et al. (1998): DB RG
Miwa Y, et al. (2000): RG
Kim JH, et al. (2005): FT
hut hutP SigA Negative 4041452..4041465 +2:+15 GTTAATAGTTATCA Wray LV Jr, et al. (1994): SDM DP
hut hutP SigA Negative 4041653..4041666 +203:+216 TGAAACCGCTTCCA Wray LV Jr, et al. (1994): SDM DP
ilvBHC-leuABCD ilvB SigA Positive 2897507..2897560 -106:-53 TGTACCAATAATGAAAGCGTATACAATATAGATTGATTAATCAAAATTGTCTAA Tojo S, et al. (2005): FT
Shivers RP, et al. (2005): FT
kdgRKAT kdgA None Negative 2323226..2323248 None ATTATGGAAGCGCTGACATTCGG Miwa Y, et al. (2000): RG
lcfA-ysiAB-etfBA lcfA None Negative 2919898..2919920 None AAAATGAAAACGTTATCAATAGT Miwa Y, et al. (2000): RG
levDEFG-sacC levD SigL Negative 2762900..2762914 -50:-36 TGAAAACGCTTAACA Martin-Verstraete I, et al. (1995): SDM DB
licBCAH licB SigA Negative 3961916..3961961 -40:+6 CTGAGTGTTTATGAAAGCGATTTCATAATATGATGATAGCAACAGC Tobisch S, et al. (1999): RG
Tobisch S, et al. (1997): HM
malA-yfiA-malP malA SigA Negative 889989..890015 -7:+20 TGGAATTGTAAACGTTATCAAGGAGGT Yamamoto H, et al. (2001): RG PE SDM
mmgABCDE-yqiQ mmgA SigE Negative 2514065..2514078 +15:+28 TGTAAGCGCTGTCT Bryan EM, et al. (1996): SDM DB
mmsA-iolBCDEF-idh-iolHI-fbaB mmsA SigA Negative 4084465..4084492 +83:+110 TTTTTGAAAGCGTTTAATTCTTGGCTTG Miwa Y, et al. (2000): DP SDM
mmsA-iolBCDEF-idh-iolHI-fbaB iolB None Negative 4082159..4082181 None GAAATGAAAACGTTGTCATCGTT Miwa Y, et al. (2000): RG
yxkF-msmX msmX None Negative 3985246..3985268 None TATAAGAAAGCGTTTACAATAAC Miwa Y, et al. (2000): RG
phoPR phoP SigA Negative 2978664..2978693 +5:+34 TTTACTATAAATGAAAGCGCTATCATAAAC Puri-Taneja A, et al. (2005): DB RG SDM GS FT
pta pta SigA Negative 3866398..3866432 -70:-35 TTTTTTATGAAAGCGCTATAATGAAAGTTGGCTGT Presecan-Siedel E, et al. (1999): FT
pta pta SigA Negative 3866335..3866374 -11:+29 ATGCTAGTAAAAGAAAGCGTTTTTGTAACTTTTTGAGGAG Presecan-Siedel E, et al. (1999): FT
rbsRKDACB rbsR SigA Negative 3701368..3701401 -11:+23 AATCTATCTATGTAAACGGTTACATAAACAAGGA Woodson K, et al. (1994): PE
sigL sigL None Negative 3513217..3513250 None AAAAAATGGAAAACGCTTTCAGTAGAGACGGGAA Choi SK, et al. (2005): SDM
trePAR treP SigA Negative 850682..850704 +362:+384 GCTGTGAAAACGCTTGCAGATAT Miwa Y, et al. (2000): RG
uxaC-yjmBCD-uxuA-yjmF-exuTR-uxaBA uxaC SigA Negative 1301623..1301645 +218:+240 CAAATGAAAGCGTTATCAAATGT Miwa Y, et al. (2000): RG
xylAB xylA SigA Negative 1891935..1891964 +132:+161 AACTATTTTGGAAGCGCAAACAAAGTGGTT Gartner D, et al. (1988): RG
Jacob S, et al. (1991): RG DP
Kraus A, et al. (1994): SDM DP RG
Chauvaux S, et al. (1998): DB RG
Kim JH, et al. (2005): PE FT
xynPB xynP SigA Negative 1887249..1887272 +219:+242 TGTTTTGAAAGCGCTTTTATAAAA Lindner C, et al. (1994): DB HB HM RG
Galinier A, et al. (1999): DP RG FT
ydhO ydhO None Negative 627939..627961 None GACTTGGAAGCGGTATCATTCCA Miwa Y, et al. (2000): RG
yobO yobO None Negative 2077380..2077402 None TTAATGTAAGCGGATTCACAGCG Miwa Y, et al. (2000): RG
yxjC-scoAB-yxjF yxjC SigE Negative 4004156..4004178 +32:+54 TTTTTGTAAACGCTTTCTAGTTC Miwa Y, et al. (2000): RG
yxkJ yxkJ None Negative 3979777..3979799 None CAATTGCAAACGGATACAATTCA Miwa Y, et al. (2000): RG
gmuBACDREFG gmuB SigA Negative ND ND ND Sadaie Y, et al. (2008): DB RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai